beta2-Adrenergic Receptor Activation and Genetic Polymorphisms in Autism: Data from Dizygotic Twins

Methods

A sample of 37 nonidentical multiple births (36 dizygotic twin pairs and one set of nonidentical triplets) was collected from our autism clinics (22 sets) and the Autism Genetic Resource Exchange database (15 sets). This genetic database includes extensive clinical and medical histories from multiplex autism families (www.agre.org).^[23] Subjects were excluded if a comorbid diagnosis existed that was known to be associated with the development of autism, such as fragile X syndrome, tuberous sclerosis complex, or neurofibromatosis.^[24,25,26] Zygosity was documented in the records of these children either by DNA or blood group testing (10 sets), gender differences (15 sets), or obvious physical differences (12 sets), such as eye and hair color. A broad autism spectrum disorder diagnosis (autism, pervasive developmental disorder, pervasive developmental disorder not otherwise specified, or Asperger syndrome) was documented in the record by a pediatric neurologist or a multidisciplinary team of autism specialists according to Diagnostic and Statistical Manual of Mental Disorders-IV, Autism Diagnostic Observation Schedule, and Autism Diagnostic Interview criteria.^[27,28,29] Twins were considered to be concordant when both had one of these documented diagnoses. The triplet set was treated as a concordant set because all triplets carried an autism spectrum disorder diagnosis.

The mother of one additional concordant twin pair underwent surgery, a considerable cause of stress,^[30] at 3 months of gestation. Maternal stress during the second trimester has been implicated in the development of autism,^[31] and sustained high maternal levels of stress hormones, such as epinephrine and norepinephrine, would likely overstimulate the fetal β₂-adrenergic receptor. Allele frequencies were studied in this additional set, and their genetic polymorphisms were included in population comparisons. This study was approved by the Institutional Review Board of The Johns Hopkins Medical Institutions.

Terbutaline exposure was evaluated by review of obstetric histories and medical records. Data on duration but not the dose of terbutaline exposure were consistently available. A dichotomous measure, exposed versus unexposed, was used in all analyses. All "exposed" twins experienced at least 2 weeks of continuous treatment with terbutaline in utero. In the unexposed group, two twin pairs received terbutaline exposure for less than 2 weeks ( Table 1 ).

The β₂-adrenergic receptor was genotyped at the polymorphic loci encoding codons 16 and 27 in 25 autistic individuals from the study: the 10 concordant twin pairs and the affected twin from the 5 discordant twin sets. Both the 16G and 27E alleles have been associated with increased receptor activity in vivo.^[21,22] All DNA samples were obtained from the Autism Genetic Resource Exchange. Polymerase chain reaction primers and conditions for amplification of the 420 basepair fragment were essentially as previously described by Martinez and colleagues.^[32] In brief, the forward and reverse primer sequences were CAGCCAGTGCGCTTACCTGC and CACAGCACATCAATGGAAGTC; 100 ng of genomic DNA template was used, the annealing temperature was 64°C, and the number of cycles was 40. The resulting polymerase chain reaction products were sequenced using an automated sequencer (ABI Prism Model 377, Applied Biosystems, Foster City, CA). Sequence data were analyzed using both ABI SeqScape software and visual inspection.

Analyses of terbutaline exposure were done with each multiple birth pair as the unit of analysis. The proportion of concordant pairs among terbutaline-exposed and nonexposed pregnancies was compared using two-tailed Fisher exact tests. Analyses were repeated in subgroups that eliminated pairs for which it could be reasonably hypothesized that other causal mechanisms could be involved. These included subjects from families in which there was a known singleton sibling from outside the twin set with an autism spectrum disorder diagnosis (these families could presumably have a higher degree of genetic loading) and sets involving members of different genders or both girls because unique mechanisms can be involved in girls, who comprise only 20% of all individuals with autism and in whom the behavioral can differ from that in boys.^[33]

Because of the small sample size, in particular the small number of discordant pairs included in the genotyping (n = 5), we did not perform a statistical analysis of the association between the β₂-adrenergic receptor genotype and autism within the study population. Rather, to provide some initial indication of whether these polymorphisms could be potentially important in conferring some increased susceptibility to autism, we compared allele and genotype frequencies in the subgroup of dizygotic twins with an autism spectrum disorder to four published reference populations from the literature.^{[32,34,35,36]} However, the subgroup of study subjects with autism spectrum disorders includes members of nonindependent twin pairs (dizygotic twins have 50% of their genotypes in common); thus, inclusion of both members of each pair for statistical analyses would artificially inflate the magnitude of any association found. Owing to these considerations, we used a random number generator to determine which member from each twin pair to include in a comparison of allele and genotype frequencies. We repeated the random selection to create a second sample of 15 subjects.

Allele frequencies at the β₂-adrenergic receptor codons 16G and 27E were compared with reference populations in four different studies using two-tailed Fisher exact tests. Both statistical analyses were performed using GraphPAD Prism 4 software (San Diego, CA). Caution must be used in interpreting these population comparisons because it is not clear that our small sample can be accurately matched with reference populations from previous studies. However, it is also not possible at this time to identify a valid source population for the subjects with autism spectrum disorder in the study group.

J Child Neurol. 2005;20(11):876-884. © 2005 BC Decker, Inc.

Cite this: beta2-Adrenergic Receptor Activation and Genetic Polymorphisms in Autism: Data from Dizygotic Twins - Medscape - Nov 01, 2005.